Seudónimo Seudónimo
  • 24-02-2017
  • Mathematics
contestada

Please help I need it done in 2 minutes

Please help I need it done in 2 minutes class=

Respuesta :

Аноним Аноним
  • 24-02-2017
The answer is 8/3

Hope this helps!
Answer Link
Аноним Аноним
  • 24-02-2017
8/3 hope this helps. Hope this helps
Answer Link

Otras preguntas

HELPPP PLEASEEEE I would really appreciate it
What is the importance of including experiences of people of all different races in education?
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
Kim's baby sister weighed 9 pounds when she was born. How many ounces are in 9 pounds?
Is there a linear relationship between the radius and the volume of these cylinders? Cylinder one: 28in^3 with a radius of 1 and height of 9 Cylinder two: 113in
Sienna earns $9.36 for each hour she works. This week she worked 15.67 hours. How much did Sienna earn this week?
Which of the statements below is true for the following set of numbers?42,20,36,51.60.28​
1. Find the slope of the line. A. [tex]-\frac{2}{3}[/tex] B. [tex]\frac{3}{2}[/tex] C. [tex]-\frac{3}{2}[/tex] D. [tex]\frac{2}{3}[/tex]
how do i simplify-1((48a^(4)b^(6) / 144a^(5)b^(3))​
i need some help on my exit ticket lol