studentinquiry studentinquiry
  • 23-03-2021
  • Biology
contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

181103
181103 181103
  • 23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

A provisional license holder under 18 may not drive without special permission _____________________ . A between 8:00 a.m. and 9:00 pm B between 12:00 am and 5:
What is the molarity of the nitric acid solution if 20.5 mL of a 0.125 M lithium hydroxide solution are needed to titrate a 25.0 mL sample of the nitric acid so
Say the words. Underline the stressed syllables. organize
How to add a answer as brainliest answer
please help, theres a picture
What color does red cabbage juice change in ammonia?
i don’t know what i’m doing lol
why is international employment important​
SCIENCE Which seafloor feature is an example of an abyssal plain?​
Select the correct answer from each drop-down menu. What is the seventh step in the accounting cycle? The fifth step in the accounting cycle is the preparation