xxrosesxx xxrosesxx
  • 26-03-2018
  • Mathematics
contestada

What’s is 17 subtract 75

Respuesta :

Аноним Аноним
  • 26-03-2018
-58 is your answer. 
17 - 75 = -58
I hope this helps!
Answer Link
thebestt1414
thebestt1414 thebestt1414
  • 26-03-2018
17-75=-58 :)
Good luck!
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What are the adaptive immune responses induced following acute and chronic infection with HIV?
A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius
Find the smallest zero for the function h(x) = 4x^2 - 8x - 60
What are motor proteins? Give 2 examples and describe how they contribute to: 1) directed movement of vesicles in protein transport 2) muscle contraction of ske
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
in millions of british pounds how much did germany spend in 1890
0-4+7-5×3÷9×5-4 do the sum of that mathematics...
A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ