Psychicc
Psychicc Psychicc
  • 25-01-2018
  • Physics
contestada

easy way to remember newtons laws? particularly 3rd

Respuesta :

sunnythefiredog sunnythefiredog
  • 05-09-2018

An easy way to remember to remember the third law is:

If you kick a soccer ball, the soccer ball will fly with the same force you kicked it with

(Please consider leaving a rate, a thanks and, a crown would be really appreciated! Thank you!)

Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
write a third degree polynomial with -2 as its only zero
simplify 355/11. i dont know
In classical conditioning, a stimulus is used to provoke or elicit a response that __________. A. it didn’t elicit naturally before conditioning occurred B. it
Which of the following is true about of realistic art? A:Some people argue that realistic art does not exist. B:Realistic art rejects fantastical images. C:It i
Creek felt pressured by Georgians to leave their land. Describe the TWO views of the Creek Nation.
Explain the adaptive advantages of a territory to the animal that establishes it.
What is the slope of (17,-15) (11,-13)
please help: y − 5x = 3 solve for y.
differentiate among the three particles of an Atom in terms of their location charge and mass