OdaSylladeltiful OdaSylladeltiful
  • 23-02-2017
  • Geography
contestada

How high is mount everest?

Respuesta :

Аноним Аноним
  • 23-02-2017
Mount Everest is 29,029 feet high.
Answer Link

Otras preguntas

in millions of british pounds how much did germany spend in 1890
Please explain how to find area of the rectangle pyramid.
What's x² + 2x + 1 factorised?
Tensile strength of a wound is directly related to the
how many atoms are present in 4.0 mol of sodium
find the quotient of 3870 and 18
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
On Monday Harold picked up four donuts and two large coffees for the office staff. He paid 4.08. On Tuesday Melinda picked up two donuts and three large coffees
help me please ,,,,,,,,ex 6 ,pleaseeee
A patient received a new heart transplant, but shows signs of graft rejection after 2 weeks. Which type of hypersensitivity reaction is in progress?" a) Type I