kmorrissette26 kmorrissette26

23-05-2022
Mathematics

contestada

What is the length of the hypotenuse? 1. 52 + 122 =c2 2. 25 + 144 =c2 3. 169=c2

Respuesta :

ataliafrazzini ataliafrazzini

23-05-2022

Answer: 13

Step-by-step explanation:

the leg lengths are 5 and 12

24+144= c^2

169=c^2

Answer Link

shy1607 shy1607

23-05-2022

The answer is 13
Hope this helps

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5

what is thunder is cause by?

Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !

Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region. which muscles are most likely to be involved in this injury?

Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.

Rulers of the Zhou dynasty established the Mandate of Heaven to ________.

What is 7 3/4 times 7?

Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination

A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea