nyraimccall9837 nyraimccall9837
  • 25-02-2022
  • Social Studies
contestada

The ______ of a media message is the underlying message and the audience's interpretation of that message.

Respuesta :

angelinaavila175 angelinaavila175
  • 07-03-2022

Answer:subtext

Explanation:

Answer Link

Otras preguntas

There are five people. One of them shot and killed one of the other five. Dan ran in the NY City marathon yesterday with one of the innocent men. Mike considere
Suggest strategies that the provincial departments of Gauteng and the Free state can implement reduce the pollution of rivers
Most email in the united states is a private conversation between only the sender and the recipient. ㅤa. trueb. false
4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this
State which plate has the fastest-rising temperature when the sunlight first falls on the plates. ..............................................................
A nurse is assessing a client who has end-stage kidney disease. which of the following findings should the nurse expect? a. Anuriab. Marked azotemiac. Crackles
Which of the following are covered by a singlemembrane?(a) Mitochondria(b) Vacuole(c) Lysosome(d) Plastid
Solve the compound inequality and choose the correct answer below -3x-9≥6 or -4x-3>1
true or false settlements are mostly permanent?​
Which of the following factors affects statistical power? 1) Type of hypothesis test 2) Significance level 3) Effect size 4) All of the above