nanadominguez01 nanadominguez01

22-12-2016
Health

contestada

The normal range of systolic blood pressure is

Respuesta :

alexsari64 alexsari64

22-12-2016

The best answer is under or less than 120
I hope this helped

Answer Link

Аноним Аноним

22-12-2016

120 beats per second
Hope i helped!

Answer Link

Otras preguntas

A. -7 B.-1 C. 1 D. 7

What is the chemical formula for a chlorine molecule wichs contains two chlorine CI atoms

Question 7(Multiple Choice Worth 2 points) Choose the most logical choice to complete each sentence. Alejandro ______leche por la mañana. bebía comía veía

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

H2SO4 + 2NH4OH → (NH4)2SO4 + 2HOH Which of these would be the BEST description of this reaction? A) reduction B) combustion C) neutralization D) single

Simplify the expression given below 5-^3•5^8/5^2

The organisms classified here all belong in the kingdom ____________ in the domain ___________. A) Animalia; Archaea B) Animalia; Eukarya C) Chordata; Eukary

in the decimal number .675 the 7 holds what place valve

During World War II, the United States violated civil rights with the ____________. A Passage of an open immigration law B Internment of Japanese Americans C

A recipe called for the ratio of sugar to flour to be 10:3 if you used 70 ounces of sugar, how many ounces of flour would you need to use