trumponly2020
trumponly2020 trumponly2020
  • 22-09-2021
  • Mathematics
contestada

49203 in scentific notation

Respuesta :

jjodlask
jjodlask jjodlask
  • 22-09-2021

Step-by-step explanation:

4.9203 x 10^4 should be the correct brainliest answer

Answer Link

Otras preguntas

find the amount of the discount on a $234 item with a discount of 15% A. $35.01 B. $40.00 C. $23.40 D. $35.10
Please help me answer these questions
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
explain the conditions for cloud formation
Which is an example of a plant with true roots? A) algae B) ferns C) liverworts D) moss
the sale price of a bicycle is $120 this is 75% of the original price find the original price
:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The
im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?
I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo
which simple machines is NOT a wedge?