yherrera2026 yherrera2026

26-08-2021
Mathematics

contestada

Estimate the value of the following to the tenths decimal place.

Estimate the value of the following to the tenths decimal place class=

Respuesta :

Starxoxxxxxxx Starxoxxxxxxx

26-08-2021

Answer:

-12.2

Step-by-step explanation:

-12.247448....

-12.2

plss mark me brainliesttt

Answer Link

Otras preguntas

can I get the answers for number 14 plz?

Factor 3s+27t. Please help me I was absent for about a week with a high fever when she taught this lesson. I'm on 73% on IXL so PLEASE HELP!

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why

what would you call a object that makes people shut up

Helpp Pleasee ASAPPPPP

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Water harvesting, the collection of rainfall and run off for future use, has been practiced for thousands of years; but in some regions where it was previously

a balanced relationship between the energy that you intake and your body's energy output is the definition of what

6 is 12% of what number

A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius