Anxbchan22 Anxbchan22
  • 24-08-2021
  • Chemistry
contestada

Convert 4752 meters into miles

Respuesta :

austin123473
austin123473 austin123473
  • 24-08-2021
2.953 miles ------------------
Answer Link
CJ410berry
CJ410berry CJ410berry
  • 24-08-2021

Answer:

2.935 miles

Explanation:

because when you convert feet into miles, it all adds up

Answer Link

Otras preguntas

Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?
Approximately, where do the numbers in the first file go in the second file's number line?If possible, post a number line like mine onto your answer and make ar
Compare and contrast the infection of a bacterial cell by a lytic bacteriophage with the infection of an animal cell by a retrovirus.
What does the term human rights mean
7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?
Which of the following choices for staying safe is the best to attempt first when trying out a new activity? A. Follow the same routine that the experts use, an
A number tripled and tripled again is 729 what is the number
What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds
in millions of british pounds how much did germany spend in 1890
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC