rajparajuli74 rajparajuli74

22-07-2021
History

contestada

who is Nepal's first prime minister ?

Respuesta :

PriyAnjalee PriyAnjalee

22-07-2021

The first general election was held in 1959 and Bishweshwar Prasad Koirala became the first elected prime minister of Nepal.

Answer Link

Otras preguntas

x=4 inches y=10 inches z=2 inches Find the volume of the figure. Round to the hundredths place.

A given wire of resistance 1 ohm is stretched to doubleits length. What will be its new resistance ?

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Select the correct text in the passage. Which detail best supports the writer's idea that "statesmanship is not an abstract skill, but a contextual one'? adapte

round to the nearest $500, what's the most expensive house carlin could buy?

The light on the top of the aquarium provides what component of an ecosystem? A biotic B producers C energy D decomposers

What is an object’s mass if the object is moving 5.6 m/s [N] and has 955 J of kinetic energy?

Can you list some examples for each of the three domains of bacteria, archaea, and eukarya?

Fill in the blanks with the vocabulary.Vocabulary:Speed of lightPhotonReflectSolar PanelsPhotoelectric Effect

necesito el area de un circulo con el radio de 3 cm.