applejacks60 applejacks60

21-04-2021
Biology

contestada

Garnet has a glassy luster. Which sample is most likely garnet?

Garnet has a glassy luster Which sample is most likely garnet class=

Respuesta :

sunnyflower53 sunnyflower53

04-05-2021

Answer:

its C the red rock on

ap.ex

Explanation:

Answer Link

Otras preguntas

Which of these substances is NOT part of cellular respiration? O a ADP Ob oxygen Ос ATP Od DNA

An analytical chemist is titrating 74.0mL of a 0.3200M solution of formic acid (H₂CO₂) with a 0.2400M solution of KOH. The pKa of formic acid is 3.74. Calculate

how to change acieve 3000 scores

The expected rates of return and the beta coefficients of the alternatives as supplied by an independent analyst are as follows: Security Return Risk (beta) Hig

When applying for a scholarship, what do you hope to accomplish at NMSU and beyond?

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

A manager in the accounting department wants to use "Employment at Will" to justify terminating an underperforming employee. The manager explains that Employmen

please help me im miserable Lines m and n are parallel lines cut by a transversal. 2019 StrongMind. Created using GeoGebra 14 23 58 n 7 6 m Which answer gives

The speed of sound in air at 20°C is 344 m/s. What is the wavelength of a sound wave with a frequency of 784 Hz, corresponding to the note G5 on a piano? How ma

Find the explicit formula for the geometric sequence: a_(3)=(3)/(4) and a_(8)=24?