tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

On a certain day, the company took 88 people on whale watching trips. There were 44 children aged twelve and under, of which some children were under three year

How do you do 859/2 using long division

What is the smallest integer, larger than 1, which is both a perfect square, and a perfect cube.?

PLEASE HELP ASAP ! 15 points .What equation is graphed in this figure? y−4=−13(x+2) y−3=13(x+1) y+2=−3(x−1) y−5=3(x−1)

what's the derivative of tan^-1 (lnx) ...?

A student designed an experiment to demonstrate the interaction between Earth systems. The steps of the experiment are given below. 1. Pour water on a bakin

A recipe uses 8 3/4 cups of milk for every 3 1/2 cups of oatmeal. How many cups of milk are used for each cup of oatmeal?

find the degree of the polynomial and determine whether it is a monomial, binomial,trinomial, or none of these 5x+7

Choose the correct simplification of the expression (3x2y3z4)(2x5y2z3). 6x7y5z7 6x10y6z12 5 x7y5z7 5x10y6z12 ...?

What other information is needed to prove that the two triangles congruent by SAS? Picture description: there are two triangles showing line LT = line MQ and L