Seudónimo Seudónimo
  • 25-03-2021
  • Mathematics
contestada

X-intercepts: (2, 0) and (4, 0)

Equation:

Respuesta :

trashboxforme12 trashboxforme12
  • 25-03-2021

Answer:

4-2=2

Step-by-step explanation:

since they are on the same quadrant you we subtract.

Answer Link

Otras preguntas

What molecule is responsible for determining the fate of each cell
A number triple and tripped again is 729 what is the number show workings
Please help me with this question
explain the conditions for cloud formation
Deinonychus were relatively small predators of the early Cretaceous. Which of the following is true about this species? a. Their claws were likely adaptations f
a balanced relationship between the energy that you intake and your body's energy output is the definition of what
only question 4 thank you
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Tensile strength of a wound is directly related to the
tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia