23saloricmanjayla 23saloricmanjayla

23-03-2021
Health

contestada

Which of the following is NOT one of the primary colors? (Red,yellow, or blue)
A. Erytho
B. Xantho
C. Cyano
D. Melano

Respuesta :

jamesonnaomi10 jamesonnaomi10

23-03-2021

Answer:

Melano

Explanation:

Hope this helps!

Answer Link

Otras preguntas

Why are there so many nerds here

As historians study history and create historical arguments, their view of history is shaped by their ______, or beliefs that help form their opinions. They may

What is the domain and range

PLEASE HELP. FIRST PERSON WITH RIGHT ANSWER GETS BRAINLIEST Given geometric sequence t find t₁ if t3=-8 and t= -256.

If 93.6 x 10^12 electrons pass through a lamp in 5 ms, what is the current in amperes?

1: Bethany and Summer are waitresses. They share the tips in the ratio of the hours they have worked. Bethany worked from 11am until 5pm. Summer worked from 1pm

The diameter of each wheel of a bicycle is 26 inches. If you are traveling at a speed of 30 miles per hour on this bicycle, through how many revolutions per mi

The label on a 3-pound bag of seeds states that it will cover an area of 288 square feet. What is the area that one pound of seeds will cover? First, reason dow

4. Using the data from your tables and the website information, describe the pattern of temperature changes within the layers of the atmosphere and why you thin

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I