maleahfigueroa4 maleahfigueroa4

22-03-2021
Mathematics

contestada

dennis had four children. Each child had three kids.

Respuesta :

danaishamark1 danaishamark1

22-03-2021

What’s the question?

Answer Link

rajoshtapaul rajoshtapaul

22-03-2021

Answer: ok lol so what is you question

Step-by-step explanation:

Answer Link

Otras preguntas

Given that y varies inversely as x, use x = 3.3 and y = 15 to find an equation that relates them. A) y = 4.6875x B) y = 16 75 x C) y = 16.75 x D) y = 49.5

"Weak, broken, and false" is an example of a _____.1) main idea2) supporting detail3) subtopic4) main topic

excerpt from Act II, Scene 1, in A Midsummer Night's Dream by William Shakespeare Titania Therefore the winds, piping to us in vain, As in revenge have sucked u

HISTORY HELP PLEASE!!

Need someone who's read Midsummer Night's Dream by Shakespeare! One theme in A Midsummer Night's Dream is the question of reality: What is real and what is a dr

which is a characteristic of an epic? A.short B.vast setting C.focuses on simple daily life events D.written with a casual tone

How was germany affected by the reformation?

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Warehouse area is 100 ft long, 200 ft wide and 16 feet high. The total weight the warehouse floor can hold is 4000 tons. What is the safe floor load in pounds

the volume of a cone with a 30-millimeter radius is 9,420 cubic millimeters.what is the height of the cone to the nearest millimeter?