golusinghara9534
golusinghara9534 golusinghara9534
  • 25-02-2021
  • Biology
contestada

hi all of you kya hua​

Respuesta :

Deborchie Deborchie
  • 25-02-2021
Hsisbbsjjnb hi hi hi hi
Answer Link
jmaita0311 jmaita0311
  • 25-02-2021

Answer:

H

Explanation:

Answer Link

Otras preguntas

Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?
Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you
Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o
what are the chromosome numbers of daughter cells in mitosis and meiosis
A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C
Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?
The heart sounds S1 and S2 are...?
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.
Need to know if these are correct, and if not what are the correct ones?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC