hel5eemarias hel5eemarias
  • 22-10-2016
  • Mathematics
contestada

Whats the solution to this inequality ? -8x>-2x-13

Respuesta :

SJ2006
SJ2006 SJ2006
  • 22-10-2016

-8x > -2x-13

adding 2x on both sides,

-6x > -13

Dividing 6,

x > 13/6

Answer Link

Otras preguntas

Identify the Bronsted-Lowry acid-base pair in the following equation: HCN + NO2- ⇌ CN- + HNO2
What is the solution to this equation?
For the statements below select the appropriate terms from the given choices. 1. A revenue not yet recognized; collected in advance. 2. Office supplies on hand
How would your priorities change if the fine on the library book was $10 a day?
(2) Solve f(x)=6 (6) Solve f(x) = 15. (c) Solve f(x) = 0. (d) Solve f(x) > 6. (e) Solve f(x) s 15, () Solve 0
How do you turn the sentence “Eat your apple, is it good for you?” Into imperative
how many atoms are in 3al(po₄)
Which lines are perpendicular?
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
should the executive and legislative branches, as well as the judiciary, possess the power tp declare what the constitution means? Why or Why not? hurry I need