israel3617 israel3617

23-11-2020
Physics

contestada

What force will be needed to accelerate a 3.5 kg atlas at 6 m/s/s

Respuesta :

Moiz324 Moiz324

23-11-2020

Answer:

123 m/s

Explanation:

Answer Link

Otras preguntas

16 1/3+8 2/5 show how you got the answer

4. What is the "enemy" of DNA?

g Consider two markets: the market for motorcycles and the market for pancakes. The initial equilibrium for both markets is the same, the equilibrium price is $

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

It is 4.0 km from your home to the physics lab. As part of your physical fitness program, you could run that distance at 10 km/h (which uses up energy at the ra

Josie's GPS shows that she traveled 20 miles in her car. Her car's odometer is slightly off and measures the distance as 24 miles. Josie's GPS shows that she tr

In chapter 6, Jane and Helen have a conversation about forgiveness and revenge. After she explains her philosophy to Jane, Helen says: "...with this creed reven

What are some of the most frequently asked questions and answers related to STDs?

is the force pushing on an object is.

a sentence with one independent clause with atleast one dependant clause is called?