vicky1230
vicky1230 vicky1230
  • 22-09-2016
  • Mathematics
contestada

726 estimated




thank you ,

vicky

Respuesta :

Аноним Аноним
  • 22-09-2016
726 to the hundred's is 700
726 to the ten's is 730

Answer Link

Otras preguntas

(b) Describe how copper sulfate solution is obtained from the plants used in phytomining.
You place 10.00mL of water in a graduated cylinder and add a 15.0g sample of iron to the water. The new water level is 11.91mL. What is the density of the iron?
Sasha is planning a holiday for 4 people for 7 days. Here are the costs for the holiday for each person. Travel Hotel Spending money Work out the total cost of
Simplify the equation please
A society's foodways are (choose best answer): A)Nonessential to its structure and survival B)Stable and unchanging over time C)Flexible and overlapping D)Produ
What's Alchemy ? Explan it in your own words ~​
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Point M is the midpoint of AC, find the coordinates of the missing endpoint when you are given one endpoint and the coordinates of the midpoint.
Divide x cubed minus 3 x squared minus 10 x + 24 by x minus 2. Step 1 - Fill in the missing number: A vertical line and horizontal line combine to make a L shap
1) A mixture of anhydrous sodium carbonate and sodium hydrogencarbonate of mass 10.000 g was heated until it reached a constant mass of 8.708 g. Calculate the c