montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

How do i solve 20m-2m

The earth exerts a gravitational force of 500N on an object. What is the mas of the object in kg?

Write 12,430,090in expanded form

Write an inequality that represents the description then solve; Max has more than 5 carrots ( number of carrots Max has = c)

How to solve -2x > 14

what steps must a historian take to evaluate historical evidence

what is the value of n? 9×27+2×31-28=

A common trait in the rise to power of Hitler and Mussolini was that they both a. ended unemployment b. universally eliminated all other political parties c.

The American Civil Liberties Union (ACLU) was founded in response to what? the postwar inflation the rise in labor strikes the Chicago race riots the Palmer Rai

List all the multiples of 4 up to 20