Shuhd3 Shuhd3
  • 24-08-2020
  • Physics
contestada

units that are greater than one liter.

Respuesta :

hassanessam557
hassanessam557 hassanessam557
  • 01-09-2020

Answer:

A dekaliter is 10 times larger than one liter (so 1 dekaliter = 10 liters)

Answer Link

Otras preguntas

The price of oil is currently at $24 but you expect it to either increase by 18 percent or decrease by 7 percent over the next 6 months. The 6-month risk-free r
Lonnie pitches a baseball of mass 0.500 kg. The ball arrives at home plate with a speed of 35.0 m/s and is batted straight back to Lonnie with a return speed of
17 __ a solution od d - 6 = 23 is it or is it not
g Phosphorus -32 is a commonly used radioactive nuclide in biochemical research, particularly in studies of nucleic acids. The half-life of phosphorus-32 is 14.
Read the following sentence from the passage. Animals would not be able to breathe if it was not for this process. How does this sentence help to develop the id
essay on personal assistants
HELP PLZZZZZZZ ITS FOR A TESTTT
2. 2. A drawing that shows the outline of an object is called​
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
$500 is placed in a savings account with an annual interest rate of 2.5%. The amount of the investment in 5 years if compounding occurs monthly is: