carsonautumn81 carsonautumn81

24-08-2020
Mathematics

contestada

(1b) Using the equation, evaluate the function. Find f (0) - f(-4)
f(x)
3x - 4 if x <-6
-*-1 if-6x<-1
4 if x 2-1

1b Using the equation evaluate the function Find f 0 f4 fx 3x 4 if x lt6 1 if6xlt1 4 if x 21 class=

Respuesta :

Аноним Аноним

24-08-2020

Answer:

Hey there!

f(-4)=-4-1, or -5.

f(0)= 4

4-(-5)

9

Let me know if this helps :)

Answer Link

Otras preguntas

Select the correct answer. Identify the weather condition that's most likely being described. una tormenta caracterizado por mucha vientos y nieve A. un tornado

It is a variety show that consist of comedic and dramatic skits in songs and dances.

A firm has just paid the 2018 annual dividend of Shs. Per share. The firm's managers expect that these dividends will increase at 10 1) 10% 2) 20% 3) 30% 4) 40%

Which sentences have a misplaced modifier? O Making sandwiches for the trip, the peanut butter was smeared across the countertop. O With a little spray cleaner,

What is the denounemeny in "An Indian Writer," by Anita Desai?

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

the area of a rectangular parking lot is 1800 sq m. the width is 14 m less than the length. what are the dimensions?

According to Stice and colleagues (2002, 2008), women with the ________ of binge eating try their best to maintain a strict low-calorie diet, but they frequentl

Use a calculator to find the natural logarithm, base e. In0.0812 In0.0812= (Round to four decimal places as needed.)

Area of the parallelogram