helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Which of the following men co-founded the NAACP? a. W.E.B. Dubois b. Booker T. Washington c. Theodore Roosevelt d. Marcus Garvey

What does the Sixth Amendment’s right to counsel guarantee an accused criminal to?

Which of the following was responsible for coordinating the economy during World War I? Selective Service Act War Industries Board Council of National Defens

is there another planet that is stable for life

What is the significance of the title of the poem Tattoo by Gregg Shapiro? a. It is a symbol for the speakers decision to let go of his families legacy and car

As a result of World War I, what happened to the federal government in the United States? The scope of its power increased. The scope of its power decreased.

Sam Adams started this group so that the colonists in various colonies could communicate with each other

What is pollination?

Discuss the accomplishments of aviation pioneers during the Golden Age. Include records, exploration, and commercial developments.

What are fern leaves called?