autumnthomas13 autumnthomas13

21-05-2020
Social Studies

contestada

PLEASE HELP!!
A situation in which people produce a narrower range of goods and services than what they consume is referred to as_____?

Respuesta :

s1187274497 s1187274497

21-05-2020

Answer:

specialization

hope this helps:) and have a nice day as well

Explanation:

Answer Link

lucykhernandez lucykhernandez

21-05-2020

Answer:

specilization

Explanation:

Answer Link

Otras preguntas

The toasters produced by a company have a normally distributed life span with a mean of 5.8 years and a standard deviation of 0.9 years, the company is willing

i’m so confused please help n=? ABC degrees EBD degrees ABE degrees CBD degrees

I need help on this Linear equation practice. Thank you

what makes us who we are? Is it our mind, soul or body? Or perhaps a combination of all three? Pls answer

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Name the types of spiritual songs.

Question Completion Status: QUESTION 1 For motion with constant velocity, how do changes in distance compare with equal changes in time? They are equal. They st

A lawn mower is pushed a horizontal distance of 20m by a force of 200n directed at an angle of 30 with the ground. What is the work of this force?

PLEASE HELP will give brainliest Explain how to find the perimeter (SHOW STEPS PLEASE)!

What effect did the US tariffs and end to foreign aid following the Stock Market Crash have on other countries? A. Exported the depression to Europe B. Boosted