guicesheketa guicesheketa

25-04-2020
Mathematics

contestada

Solve using the correct law of exponents .5.947 x 9^-5 = *

Respuesta :

abdinimo45 abdinimo45

25-04-2020

Answer:

5.947x9−5

Step-by-step explanation:

that's the answer

Answer Link

Otras preguntas

Anna said that the product of 7/8 times 1 1/2 equals 7/2. How can you tell that her answer is wrong?

Read the sentence. Marcus threw the baseball to his teammate. Which best identifies the voice verb in this sentence? ⬆️⬆️VIEW PICTURE ABOVE⬆️⬆️

DNA in the nucleus is found in structures called _____. organelles pores ribosomes chromosomes

DNA tacaggtacccgaacccaattta

do the math for 3w+6=4w

definition of Winston Churchill

A yellow and green car traveled 400 miles to Dayton, OH. The green car made the trip in 10 hours. The yellow arrived in 8 hours. Calculate the speed of each

How did city planners solve the public health problems posed by polluted rivers and lakes? Planners developed more factories in urban areas. Planners pa

what actions may agent chan take during the event

Jenny paid $8.54 for a pizza. She now has $16.79. With how much money did she start?