ethantylarhatfield22 ethantylarhatfield22

24-03-2020
Mathematics

contestada

The product of two numbers is 144, but their sum is -24. What are these two numbers?

Respuesta :

bunnyroberson65 bunnyroberson65

24-03-2020

These two number are whole number

Answer Link

ryan11061 ryan11061

24-03-2020

Answer:

the answer is -12

Step-by-step explanation:

(-12) x (-12) = 144 but (-12)+(-12) = -24

Answer Link

Otras preguntas

what is 0+50×1-60×0+10=

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What was the primary reason for the English colonization of Jamestown in 1607 near the James river

Which process must occur before collection? A:precipitation B:condensation C:evaporation D:none of the above

Sarah's class recycled 3. 7 7/9 boxes of paper in a month. If they recycled another 9 2/8 boxes the next month what wasvthe total amount recycled

Which of the following best describes what most experts believe about Homo sapiens? a.they arose out of Africa less than 200,000 years ago b.they arose from Nea

Write a recursive function for this sequence 8,12,18,27..

What are the three differences between The Quran and the Gospel??

how would living in Sparta or Athens be like

Please answer and put how