hospedalesalexis hospedalesalexis

25-01-2020
Mathematics

contestada

-(2)negative negative two quotation to the zero power equals

Respuesta :

AnimeBrainly AnimeBrainly

25-01-2020

Answer:

1

Step-by-step explanation:

While I am not 100% sure what you are putting (I'm assuming it's -2^0), anything to the power of 0 will equal a positive 1 as your answer.

Answer Link

Otras preguntas

A rectangular napkin costs $3.25. A similar tablecloth is five times longer and five times wider. If the costs is proportional to the area of the napkin, how mu

What figurative language does the narrator use to describe her life in "mother to son"??

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

According to Riis how did the rise of civilization lead to slums

Which statement best describes Sputnik 1? Question 16 options: first man-made earth satellite launched by the Soviet Union first US spacecraft put in to orbit f

help me with this and explain please!?

find the factors of the expression 8x6 + 27y

read this excerpt from act ll, scene ll, of romeo and juliet. which theme is depicted through juliets monologue

A song has 28 beats in 4 seconds. At this rate, how many beats are there in 30 seconds? what is the answer?

In chicago, a city with more polish people than anywhere else in the united states, casimir pulaski day is always a very important holiday. although not well re