studyqueen1717 studyqueen1717
  • 25-11-2019
  • English
contestada

What chapter is this quote found in First of all,...if you can learn a simple trick, Scout, you'll get along a lot better with all kinds of folks. You never really understand a person until you consider things from his point of view---.

Respuesta :

mymamasmunchkin mymamasmunchkin
  • 25-11-2019

Answer:

I think it is Chapter 3

Explanation:

Answer Link

Otras preguntas

what procedure could you use to test the effect of a catalyst on a reaction
Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18
How do short-term goals differ from long-term goals?
I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2
​What is the primary way that combination birth control pills work to prevent pregnancy?
why is the work output always less than the work input?
I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2
what are the 3 care instructions for future life on earth
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what finger does the ring go on