Seudónimo Seudónimo
  • 23-06-2019
  • Mathematics
contestada

...................​

 class=

Respuesta :

prithak44
prithak44 prithak44
  • 24-06-2019

Answer:

fdg=gce ( vertically opposite angle)

or,fdg=23

Step-by-step explanation:

or, x+fdg = 90 (supplementary angle)

or,x+23=90

or, x =90-23

or,x=67

so, the value of x is 23

Answer Link

Otras preguntas

What are the three differences between The Quran and the Gospel??
what is The Original Price of an item if it is discounted 36% and the selling price is 32$
one reason President Johnson created the Great Society program was to
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart
how was sam houston passionate? give atleast 2 examples with explanation
The question is in attachment
Who owned the land that is now Florida before it became part of the United States? A. France B. Great Britain C. Spain D. Mexico
7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
How would your study of early China have been different if you were studying 100 years ago?