jofox678 jofox678
  • 23-03-2019
  • Geography
contestada

is it ture that wind moves easily across the plains​

Respuesta :

kiiii1 kiiii1
  • 23-03-2019

Yes it is true that winds move easily across the plains.

Answer Link

Otras preguntas

What is a traditional economy built on?
Question 1 2 pts If an object is lifted up so that it has 100 joules of energy, how much energy would the object have if it were lifted up three times as high?
Not sure how to find a and b?
Who was Pseudo-Dionysius? a. A master builder during the Gothic period b. Writer of many Greek myths c. A Greek philosopher d. None of the above Please select t
Hi I really need help with this question please i really need Help (correct only) Which data display could be used to represent the data set? 106, 94, 83, 115,
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
im not good with math so i need help.
HELP! P/4 < 2 What does p=?
A In response to the sanitation issues of the city, how did the city respond? A. The city would heavily fine people who littered. B. The city started to provide
a box of cereal states that there are 90 calories in a 3/4 cup serving. How many Calories are there in 4 cups of the cereal?