spartanemile07 spartanemile07

24-10-2018
Mathematics

contestada

Given:

Write the equation in general form Ax + By + C =0.

Respuesta :

ifeoluwaakinrip6qdgr ifeoluwaakinrip6qdgr

24-10-2018

Answer:

x = [tex]\frac{-b +-√b²-4ac}{2a}[/tex]

Step-by-step explanation:

I think you mean this : x = [tex]\frac{-b +-√b²-4ac}{2a}[/tex]

Answer Link

Otras preguntas

Fluorine reacts with copper to form an ionic compound. Explain, in terms of electrons and electronic structure, what happens to a fluorine atom when it reacts w

Rewrite the following sentences with the correct form of verb selecting from the brackets: a. She always (play) Football. b. They (not see) a tiger yet. c. At p

A clothing business finds there is a linear relationship between the number of shirts, n ,it can sell and the price, p , it can charge per shirt. In particular

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Triangle JKL is rotated 180° clockwise about the origin. A four quadrant coordinate plane is shown. Triangle J K L is graphed. Point J is located at three comma

Uncorrected Text National Football League (NFL) teams do alot to get ready for the knew football season that begin each fall. In april, the league holds a draft

Question 3 Non-response bias occurs in ad-hoc mail surveys with which group of people? O those with interest in the topic O those with less education O students

What was the first continental congress and what did they do?

Reading Check Comparing How is Islam similar to Judaism and Christianity?

Poncho puede hacer una obra en tres días y Kevin en cinco días en cuánto tiempo pueden hacer la obra trabajando los dos juntos respuesta algebraica