lalalalalaLALALAlol
lalalalalaLALALAlol lalalalalaLALALAlol
  • 23-09-2018
  • Mathematics
contestada

Tony and his brother had to shovel the snow. Tony worked 3/5 of an hour. His brother worked 2 1/2times longer. How long did his brother work?

Respuesta :

lopezgadicha17
lopezgadicha17 lopezgadicha17
  • 23-09-2018

(3 / 5) * 2 1/2 = 1.5

Answer Link

Otras preguntas

Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
choose the correct helping verb the tadpoles have or had moved into the pond
an object is launched upward from ground level and reaches a maximum height of h feet. The initial velocity v (in feet per seconds) of the object is given by th
1/3 x 1/5 in the simplest form
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
who is the first presiden of United States?
Helpp Pleasee ASAPPPPP
Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?
PLEASE HELP ME ASAP 10 POINTS
What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?