rickross3483 rickross3483

22-01-2024
Medicine

contestada

Which of the following types of shock is not characterized by generalized vasodilation and peripheral pooling of blood?
A. Anaphylactic shock
B. Neurogenic shock
C. Septic shock
D. Cardiogenic shock

Respuesta :

Otras preguntas

2 The diagram shows a kite. Find the size of angle a. 100° 121° A

When George was born, his father was 36 years old. George is now 10% of his father's age. How old is George now?

que paises de europa hablan lenguas romanicas

Podpisz obrazki. Podkreśl spółgłoski zapisane po spółgłoskach miękkich

Which of the following can be added to the number indicated on the number line above to sum to 0? OA 0.6 OB. 1.4 OC -1.4 OD. -0.6

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

shkole 2. Réponds aux questions. 1. De quoi parle ce texte ? 2. Où se trouve la ville de Kamyanets-Podilsky ? Peux-tu trouver cette Yah hoje vshkole ville sur l

Why is English important I’m very bored

100 points please help asap

Please Help!!! Will give brainliest!!!