kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

round 30,944 to the nearest ten thousand

How to write the number name for the number that is 1,000 more than 27,491

58,927 in scientific notation

24 divided by -5 = -4.8. How do you get the .8? I know 5 goes into 20 4 times so the answer is -4.8, but I don't know the step of how to get the .8 without usin

n/5 - 5n/10= 1/5 please explain. I semi understand it but still explain thoroughly.

Which sentence uses commas correctly? A.Theo, is there a bug on my back? B.Please Beth, feed the goldfish. C.I wonder, Mike if everyone has already left. D.

304,001 in two forms

why do the us government intervene in the economy during the finanacial crisis in 2008

Is it true or false that food availability and temperature can be biotic factors for a particular organism?

Which is the best unit of measure for the amount of hot cocoa in a thermos?