15188198 15188198

21-11-2022
Mathematics

contestada

What is the principal square root of -25?
No Real Number
-5
5
1/6

Respuesta :

Otras preguntas

Which of the following does Saturn have in common with Earth?

The density and concentration of a given area __________.

Four people are applying for a job. This chart shows the company’s favorite characteristic of each of these job applicants: Which describes the reasons each app

The form of oxygen that combines three oxygen Adams into each molecule is called

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Write a 100 word description of Sam Houston.

30 POINTS + BRANLIEST! A bag contains 3 red, 5 brown, and 4 yellow potatoes. What is the probability of randomly choosing 2 yellow potatoes without replacement?

Select the word(s) that should be capitalized. month labor day good Friday war

How did the Soviet invasion of Afghanistan contribute to the fall of the Soviet Union? Select all the correct answers 1.The Red Army lost its strength and re

which american leader while attending the Potsdam conference issued a warning to japan to surrender or face complete destruction